Tags:
create new tag
, view all tags

admp

anti-dorsalizing morphogenic protein

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0

GeneInformationForm
GeneName admp
Aliases ENSDARG:ENSDARG00000025372; fe05b04; wu:fe05b04; admp
Description anti-dorsalizing morphogenic protein
GenomicLocation chromosome 2 54071703-54087723 reverse strand
ExternalIDs Entrez:140619; EMBL:AF420475; UniGene:80639; ZFIN:ZDB-GENE-011214-1;
TranscriptID ENSDART:ENSDART00000037557
mRNA NCBI:NM_131876
GeneDescription This gene is responsible for anterior and axial development
GeneFunction Dickmeis et al. (2001) experimentally showed that zebrafish admp is expressed in involuting cells of embryonic shield. A high admp expression is first detectable during early blastula stage on one side of the blastoderm cap, experimental analysis revealed that this expression defines prospective dorsal side of the embryo even before it is morphologicaly visible.During early neural stage the admp is expressed in the precordal plate and in tail bud region.Willot et al. (2002) reported that admp expression profile is consistent with a role in the organizer, including the tail organizer.admp is expressed asymmetrically in the blastoderm ,after the midblastula transition. At the sphere stage it is expressed in nearly whole of the blatoderm in a radially asymmetric way. At the onset of gastrulation it encompasses the embryonic shield and zebrafish organizer.To establish admp role they also conducted admp overexpression experiments, it was found that admp overexpression results in three classes of phenotypesclassI- exhibited notochord disruption in the tail, a shorter axis and slightly smaller head and eyes class 2 showed notochord disruption in the trunk, fused somites and smaller head and eyes class 3 had a complete loss of notochord and strongly reduced head and eyes
GeneCloning

GeneStructure This gene encodes a single transcript (ENSDART00000037557) which consists of 5 exons and is 1,864 bps in length. The protein product (ENSDARP00000037833) consists of 391 residues.
Protein ENSDARP00000037833
ProteinDomainandFamilies has domain InterPro:IPR015615; InterPro:IPR001839; InterPro:IPR001111; InterPro:IPR017948;
Motifs has motif Prosite:PS00250; Prosite:PS51362; PFAM:PF00019; PFAM:PF00688; PRINTS:PR01423;
Expression ArrayExpress:ENSDARG00000025372;
GeneOntology GO:0040007; GO:0008083; GO:0005576;
Orthologs

VariationAndRepeats RSID:rs40678056; RSID:rs40812672; RSID:rs41163727; RSID:rs41156753; RSID:rs40899595; RSID:rs41006782; RSID:rs40846609;
DisordersAndMutations M01:5' - CAAAGAACATTGCAGACAACATGAT - 3 M02:5' - TGGACAACATTGTAAAGAACATTGC - 3'
RelatedPubMedArticles Dickmeis, T.; Rastegar, S.; Aanstad, P.; Clark, M.; Fischer, N.; Korzh, V.; Strähle, U.: Expression of the anti-dorsalizing morphogenetic protein gene in the zebrafish embryo. Dev Genes Evol.;211(11):568-72, 2001. PMID:11862464 Willot, V.; Mathieu, J.; Lu, Y.; Schmid, B.; Sidi, S.; Yan, Y.L.; Postlethwait, J.H.; Mullins, M.; Rosa, F.; Peyriéras, N.: Cooperative action of ADMP- and BMP-mediated pathways in regulating cell fates in the zebrafish gastrula. Dev Biol. 1;241(1):59-78, 2002. PMID:11784095 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r2 - 2013-07-06 - DivyaJagga
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort