Tags:
create new tag
, view all tags

acvr1

ACVR1 activin A receptor, type I like

Rate Information on this Page
Score: 0, My vote: 0, Total votes: 0


GeneInformationForm
GeneName acvr1
Aliases ENSDARG:ENSDARG00000014986; lost a fin; mini fin; laf; mfn; alk2; alk8; alk8sum; fk50h05; wu:fk50h05; etID124543.2; acvr1
Description ACVR1 activin A receptor, type I like
GenomicLocation chromosome 2 41563236-41583420 reverse strand
ExternalIDs Entrez:30615; EMBL:AF038425; UniGene:75831; ZFIN:ZDB-GENE-990415-9;
TranscriptID ENSDART:ENSDART00000017977; ENSDART:00000122860; ENSDART:00000127520; ENSDART:00000140138;
mRNA NCBI:NM_131345
GeneDescription Alk8/acvr1 is a type I TGFbeta family member receptor. It has been known to act in bone morphogenetic protein (BMP) signaling pathways to establish dorsoventral patterning in the early zebrafish embryo.
GeneFunction Payne TL et al. (2001) performed the functional characterization and genetic mapping of the alk8 gene. They analysed the phenotypic defects of the zebrafish dorsalized mutant, lost-a-fin. Their functional, gene mapping and phylogenetic analyses suggested that alk8 may be the zebrafish orthologue to human ACVRI (alk2).Bauer H et al. (2001) showed that The type I serine/threonine kinase receptor Alk8/Lost-a-fin is required for Bmp2b/7 signal transduction during dorsoventral patterning of the zebrafish embryo and acts upstream of smad5. They found that dorsalized phenotype of lost-a-fin zebrafish mutants is caused by null mutations in Alk8 gene and also described two muatant alleles of the alk8 gene, the lafm100 and lafm110.De Caestecker MP et al. (2002) reported that Alk8 forms active signaling complexes with TGF-beta in the presence of TGF-betaRII. Their results demonstrated the involvement of zAlk8 to participate in two distinct TGF-beta subfamily signaling pathways.Payne TL et al. (2003) demonstrated that alk8 is required for neural crest cell (NCC) formation and that alk8 signaling gradients direct the proper patterning of premigratory NCCs. Alk8 was shown to affect the anteroposterior arch cartilage formation. Alk8 was also shown to regulate the patterning of pharyngeal mesodermal and endodermal tissues. They provided an insight into alk8-mediated BMP signaling gradients and the establishment of premigratory NCC mediolateral positioning.Payne TL et al. (2004) investigated the regulatory elements of the ubiquitously expressed maternal mRNA of the alk8 which later exhibits more restricted zygotic gene expression. Analysis of the nucleotide sequence of the 2.6 kb alk8 promoter element provides insight into the regulation of maternal alk8 gene expression and revealed that Maternal alk8 promoter fragment directs expression in early oocytes.Perrino MA et al. (2004) observed immunolocalization of Alk8 to tissues of the tooth-bearing ceratobranchial 5 (cb5) arch suggesting a role for Alk8 in patterning tooth-bearing pharyngeal epithelium, in the initiation of tooth development, in odontoblast and ameloblast differentiation, and in osteoblast maturation.Hogan BM et al. (2006) showed that Bmp receptor lost-a-fin/alk8 is required for rostral pu.1 expression and myelopoiesis, identifying an early genetic event that distinguishes between the induction of anterior and posterior hematopoiesis. They stated that role of Alk8 in myelopoiesis was genetically separable from its earlier role in dorsal-ventral embryonic patterning.
GeneCloning The gene is contained in the BAC clone CH211-62C1 (Vector: pTARBAC2.1).
GeneStructure This gene encodes four transcripts:The transcript ENSDART00000017977 consists of 11 exons and is 3,643 bps in length.The protein product (ENSDARP00000003221) consists of 506 residues.The transcript ENSDART00000097735 consists of 9 exons and is 1,413 bps in length.The protein product (ENSDARP00000088506) consists of 471 residues.(NOVEL)The transcript ENSDART00000122860 consists of 3 exons and is 457 bps in length. The protein product (ENSDARP00000108954) consists of 106 residues. The transcript ENSDART00000127520 consists of 9 exons and is 3.945 bps in length. The protein product (ENSDARP00000111550) consists of 506 residues. The transcript ENSDART00000140138 consists of 2 exons and is 396 bps in length.
Protein ENSDARP00000003221 ENSDARP00000108954 ENSDARP00000111550
ProteinDomainandFamilies has domain InterPro:IPR003605; InterPro:IPR017442; InterPro:IPR000719; InterPro:IPR017441; InterPro:IPR000472; InterPro:IPR008271;
Motifs has motif Prosite:PS00107; Prosite:PS00108; Prosite:PS50011; Prosite:PS51256; PFAM:PF00069; PFAM:PF01064; PFAM:PF07714; PFAM:PF08515; PRINTS:PR00109; PRINTS:PR00653;
Expression ArrayExpress:ENSDARG00000014986;
GeneOntology GO:0016020; GO:0005737; GO:0005938; GO:0005887; GO:0021556; GO:0048264; GO:0048332; GO:0009953; GO:0006468; GO:0007368; GO:0035050; GO:0042475; GO:0035162; GO:0060030; GO:0046588; GO:0001944; GO:0030509; GO:0035124; GO:0030510; GO:0051216; GO:0007420; GO:0009952; GO:0042476; GO:0005524; GO:0004675; GO:0005024; GO:0004672; GO:0004674; GO:0016301; GO:0004872;
Orthologs Entrez:90;
VariationAndRepeats RSID:rs41165841; RSID:rs40944003; RSID:rs40795453; RSID:rs41049923; RSID:rs41179978; RSID:rs40923022; RSID:rs40830165;
DisordersAndMutations The Lost-a-fin mutants disrupted in the alk8 gene involved in dorsoventral patterning, has been characterized to show defects craniofacial development by examining NCC and pharyngeal arch cartilage formation in embryos. Two alleles laftm110 and lafm100 have been isolated previously. laftm100 mutant embryos revealed a TGC 61614 CGC mutation causing a Cys to Arg exchange at amino acid position 91 in the extracellular domain of the Alk8 receptor.The laftm110 mutant allele shows CGA 61614 TGA nonsense mutation, introducing a premature stop codon at position 145 (Bauer H et al., 2001). alk8morph1 (CAACTCCTCAAGTGACTCTCAGCG), and alk8morph2 (GATTCATGTTTGTGTTCAATTTCCG), have been used to knockdown the gene Acvr1 (Bauer H et al., 2001). ZFINID:ZDB-GENO-060403-1; ZFINID:ZDB-GENO-070710-3; ZFINID:ZDB-GENO-110804-6; ZFINID:ZDB-GENO-091210-4; ZFINID:ZDB-GENO-980202-162; ZFINID:ZDB-GENO-100701-4; ZFINID:ZDB-GENO-100701-5; ZFINID:ZDB-GENO-070209-237; ZFINID:ZDB-GENO-070710-4; ZFINID:ZDB-GENO-090417-6; ZFINID:ZDB-GENO-980202-960; ZFINID:ZDB-GENO-110131-43; ZFINID:ZDB-GENO-080731-4; ZFINID:ZDB-GENO-061204-4;
RelatedPubMedArticles Payne, T.L.; Skobe, Z.; Yelick, P.C.: Regulation of tooth development by the novel type I TGFbeta family member receptor Alk8. J Dent Res.;80(11):1968-73, 2001. PMID:11759004 Payne, T.L.; Postlethwait, J.H.; Yelick, P.C.: Functional characterization and genetic mapping of alk8. Mech Dev. ;100(2):275-89, 2001. PMID:11165484 Bauer, H.; Lele, Z.; Rauch, G.J.; Geisler, R.; Hammerschmidt, M.: The type I serine/threonine kinase receptor Alk8/Lost-a-fin is required for Bmp2b/7 signal transduction during dorsoventral patterning of the zebrafish embryo. Development.;128(6):849-58, 2001. PMID:11222140 de Caestecker, M.P.; Bottomley, M.; Bhattacharyya, S.; Payne, T.L.; Roberts, A.B.; Yelick, P.C.: The novel type I serine-threonine kinase receptor Alk8 binds TGF-beta in the presence of TGF-betaRII. Biochem Biophys Res Commun. ;293(5):1556-65, 2002. PMID:12054694 Payne-Ferreira, T.L.; Yelick, P.C.: Alk8 is required for neural crest cell formation and development of pharyngeal arch cartilages. Dev Dyn.;228(4):683-96,2003. PMID:14648845 Payne-Ferreira, T.L.; Tong, K.W.; Yelick, P.C: Maternal alk8 promoter fragment directs expression in early oocytes. Zebrafish.;1(1):27-39, 2004. PMID:18248203 Perrino, M.A.; Yelick, P.C.: Immunolocalization of Alk8 during replacement tooth development in zebrafish. Cells Tissues Organs. ;176(1-3):17-27,2004. PMID:14745232 Hogan, B.M.; Layton, J.E.; Pyati, U.J.; Nutt, S.L.; Hayman, J.W.; Varma, S.; Heath, J.K.; Kimelman, D.; Lieschke, G.J.: Specification of the primitive myeloid precursor pool requires signaling through Alk8 in zebrafish. Curr Biol.;16(5):506-11, 2006. PMID:16527746 NCBI Resource Coordinators.: Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 41(Database issue):D8-D20. 2013. PMID:23193264
Kersey, P. J.; Allen, J. E.; Christensen, M.; et al.: Ensembl Genomes 2013: scaling up access to genome-wide data. Nucleic Acids Res. 2013. PMID:24163254
Sigrist, C. J. A.; de, Castro, E; Cerutti, L; Cuche, B. A.; Hulo, N.; Bridge, A.; Bougueleret, L. Xenarios, I.: New and continuing developments at PROSITE. Nucleic Acids Res. doi: 10.1093/nar/gks1067. 2012. PMID:23161676
Punta, M.; Coggill, P. C.; Eberhardt, et al.: The Pfam protein families database. Nucleic Acids Res. 40(Database Issue):D290-D301. 2012. PMID:22127870
Hunter, S.; Jones P.; Mitchell A.; et al.: Interpro in 2011: new developments in the family and domain prediction database. Nucleic Acids Res. doi: 10.1093/nar/gkr948. 2011. PMID:22096229
Carbon, S.; Ireland, A.; Mungall, C. J.; Shu, S.; Marshall, B.; Lewis, S.; AMIGO Hub; Web Presence Working Group.: AMIGO: online access to ontology and annotation data. Bioinformatics. 25(2):288-9. 2009. PMID:19033274
Ashburner, M.; Ball, C. A.; Blake, J. A.; et al. The Gene Ontology Consortium.: Gene ontology: tool for the unification of biology. Nat. Genet. 25(1):25-9. 2000. PMID:10802651
Sherry, S. T.; Ward, M. H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E. M.; Sirotkin, K.: dbSNP: the NCBI database of genetic variation. Nucleic Acids Res. 1;29(1):308-11. 2001. PMID:11125122
Bradford, Y.; Conlin, T.; Dunn, N.; et al.: ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res. 39(suppl 1):D822-D829. 2011. PMID:21036866
Kapushesky, M.; Adamusiak, T.; Burdett, T.; et al.: Gene Expression Atlas update--a value-added database of microarray and sequencing-based functional genomics experiments. Nucleic Acids Res. 40(Database isue):D1077-81. 2012. PMID:22064864

Web resources:
NCBI: http://www.ncbi.nlm.nih.gov/
PFAM: http://pfam.sanger.ac.uk/
PROSITE: http://prosite.expasy.org/
Interpro: http://www.ebi.ac.uk/interpro/
ZFIN: http://zfin.org/
Expression Atlas (EMBL): http://www.ebi.ac.uk/gxa/
Ensembl: http://asia.ensembl.org/Danio_rerio/
Database of Single Nucleotide Polymorphisms (dbSNP). Bethesda (MD): National Center for Biotechnology Information, National Library of Medicine.: http://www.ncbi.nlm.nih.gov/SNP/
PRINTS from Genomenet: http://www.genome.jp/
European Nucleotide Archive: http://www.ebi.ac.uk/ena/home
UNIGENE: http://www.ncbi.nlm.nih.gov/unigene/
AMIGO Gene Ontology: http://amigo.geneontology.org
Topic revision: r3 - 2014-01-09 - MeghnaSingh
 
This site is powered by the TWiki collaboration platform Powered by PerlCopyright © 2008-2017 by the contributing authors. All material on this collaboration platform is the property of the contributing authors.
Ideas, requests, problems regarding TWiki? Send feedback

mersin escort bayan adana escort bayan izmit escort ankara escort bursa escort