Transcript
      Expression
      Mutation
      Predicted ORFs
      Variation
      References

ZF_LNC001596

Transcript Name: lnc4_si:dkey-207j16.2
Type: lincRNA
Genomic Location: chr4:9858189-9876811
Nearest Gene: si:dkey-207j16.2 (NM_001045067)


lnc4_si:dkey-207j16.2
Exons
98581899876811



Expression Information

Negligible Expression across RNA-Seq datasets





Mutant Information


ChromosomeMutant PositionZFIN ID

No retroviral insertion mapping detected




Predicted Open Reading Frames


ORFRangeSequence

Variant Information


Variant PositionrsIDReferenceAlternate
9858279 rs179372135 T C
9858322 rs179372208 C G
9858338 rs179372346 A G
9858411 rs179372284 A T
9858414 rs179372158 G A
9858416 rs179372304 C T
9858424 rs179372234 C A
9858434 rs179372306 T A
9858436 rs179372180 T A
9858460 rs179372274 A G
9858464 rs179372175 G T
9858516 rs179372347 A G
9858574 rs179372279 T A
9858605 rs179372313 G C
9858624 rs179372188 G T
9858669 rs40645466 TAACAACAACAACAACAACAACAACAAC TAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAC
9861938 rs179372286 A T
9861943 rs179372161 T C
9861944 rs179372249 G A
9861946 rs179372343 C T
9861947 rs179372241 T G
9861949 rs179372267 T C
9861978 rs179372184 G A
9861982 rs179372148 A T
9864265 rs40644972 T G

References

lncRNA has been predicted by:

Ulitsky I, Shkumatava A, Jan CH, Sive H, Bartel DP
Conserved function of lincRNAs in vertebrate embryonic development despite rapid sequence evolution.
Cell(2011) 147: 1537-1550
PMID:22196729

Expression information has been derived from:

Retroviral insertion lines mapping to lncRNA loci has been derived from: